Gene Name | 45S rRNA gene intergenic spacer | Gene Symbol | 45SrRNAint | |||
Chromosome | Unlocalized | Genomic Location | Unlocalized | ![]() |
||
Synonyms | ||||||
Links |
UCSC Genome Browser(Unlocalized) NCBI Gene() IGTC(45SrRNAint,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
21-B148, 21-MT55, 21-MT9, 21-108, 21-T335, 21-T23, 21-39, 21-B113, 21-MT81, 21-T105, 21-B130, 21-MT6, 21-T107, 21-MT33, 21-MT71, 21-MT35, 21-MT14, 21-MT10, 21-MT37, 21-MT75, 21-MT86, 21-MT7, 21-MT49, 21-MT68, 21-T212, 21-T223, 21-T235, 21-T251, 21-MT2, 21-MT34, 21-MT69, 21-MT77, 21-MT43, 21-MT26, 21-MT100, 21-MT104, 21-MT106, 21-MT112, 21-MT125, 21-MT128 |
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-Inverse PCR |
Accession | DE999372 | GSS Location | Unlocalized | Size | 160 |
Sequence | CAANTAAAAGTANAAGGGGAAAAAAAAAAAAAAAGTTAAAGATCACTTTGTTAGAACTTTTCTAT ATTGTAATNNNCATTATACGGCTTGACATCCAAACTCTCTGGTTCACTAGCACATCTTCCCAATG CAATGTCTACCGTCTTCCCCCATGATTTTT |
||||
Links |
UCSC Browser(Unlocalized) IGTC(Ayu21-B143) |
[BK000964] TPA_exp: Mus musculus ribosomal DNA, complete repeating unit. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and ES cell line; KTPU8. This clone has not been subjected to chimeric mice production. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR. | ||||
Links |
IMSR (for 45SrRNAint) |