ID 21-128
Registered: 2004.06.01 Last update: 2011.02.06
| Gene Name | solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 | Gene Symbol | Slc7a2 | |||
| Chromosome | 8 | Genomic Location | chr8:41,944,000-42,010,000 |  |
||
| Synonyms | Tea, Cat2, Atrc2 | |||||
| Links |
UCSC Genome Browser(chr8:41,944,000-42,010,000) NCBI Gene(11988) IGTC(Slc7a2,19330) UNIGene(Mm.4676) |
MGI(99828) KEGG GENES(mmu:11988) EST Profile(mm.4676) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W156 |
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187263 | GSS Location | chr8:41,947,771-41,947,911 | Size | 141 |
| Sequence | GAGCTTCTGTCTGCGCGGACCTGGAAAGGCTGCTGCTGCTGCTCGTCCAACCTTCGCGAGCTTGG AATCCGCAGAGCGCTGCAGCCTCTCGCTCGCCCGTGCCTGCTCCCGTCCCCGTCGCGCGGCCAGG GCACTGCCCCA |
||||
| Links |
UCSC Browser(chr8:41,947,771-41,947,911) IGTC(Ayu21-128) |
||||
Homology Search Results
| [U35650] Mus musculus cationic amino acid transporter (mCAT2) mRNA, 5'UTR. |
Mouse Information
| Card ID | 441 | ||||
| Strain Name | B6;CB-Slc7a2Gt(Ayu21)128Imeg | ||||
| Internal Code | Ayu21-128 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Slc7a2) |
||||