ID 21-W156
Registered: 2008.10.29 Last update: 2018.06.15
| Gene Name | solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 | Gene Symbol | Slc7a2 | |||
| Chromosome | 8 | Genomic Location | chr8:41,944,000-42,010,000 |  |
||
| Synonyms | Tea, 20.5, Cat2, Atrc2, CAT-2, AI158848 | |||||
| Links |
UCSC Genome Browser(chr8:41,944,000-42,010,000) NCBI Gene(11988) IGTC(Slc7a2,19330) UNIGene(Mm.4676) |
MGI(99828) KEGG GENES(mmu:11988) EST Profile(mm.4676) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-128 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB468966 | GSS Location | chr8:41,947,744-41,947,911 | Size | 168 |
| Sequence | GCCCGCCTTCTGCAAGCTCGGCGGCGGGAGCTTCTGTCTGCGCGGACCTGGAAAGGCTGCTGCTG CTGCTCGTCCAACCTTCGCGAGCTTGGAATCCGCAGAGCGCTGCAGCCTCTCGCTCGCCCGTGCC TGTTCCCGTCCCCGTCGCGCGGCCAGGGCACTGCCCCA |
||||
| Links |
UCSC Browser(chr8:41,947,744-41,947,911) IGTC(Ayu21-W156) |
||||
Homology Search Results
| [U35650] Mus musculus cationic amino acid transporter (mCAT2) mRNA, 5'UTR. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Slc7a2) |
||||