ID 21-B101
Registered: 2005.12.21 Last update: 2011.02.06
| Gene Name | forkhead box J2 | Gene Symbol | Foxj2 | |||
| Chromosome | 6 | Genomic Location | chr6:122,770,000-122,795,800 |  |
||
| Synonyms | Fhx | |||||
| Links |
UCSC Genome Browser(chr6:122,770,000-122,795,800) NCBI Gene(60611) IGTC(Foxj2,247) UNIGene(Mm.87142) |
MGI(1926805) KEGG GENES(mmu:60611) EST Profile(mm.87142) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB244781 | GSS Location | chr6:122,770,832-122,770,988 | Size | 157 |
| Sequence | ACTCAGTTCCCTGCTCCAGCCTGGGAGGCTCCGCCAGGCACTGGAAGAGTCACTGAGGATGCCAC CTGTCACCCGCCTCTGAAGAGGGGAATCCCTGCAACCTCAAACTTCTGTACCAGGTGGTTTCCTC CAGCGGCGGGGGGAGCCTTGGAGACAG |
||||
| Links |
UCSC Browser(chr6:122,770,832-122,770,988) IGTC(Ayu21-B101) |
||||
Homology Search Results
| [BC040395] Mus musculus forkhead box J2, mRNA (cDNA clone MGC:28510 IMAGE:4190087), complete cds. |
Mouse Information
| Card ID | 649 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Foxj2) |
||||