ID 21-B104
Registered: 2005.12.21 Last update: 2018.04.05
| Gene Name | tousled-like kinase 1 | Gene Symbol | Tlk1 | |||
| Chromosome | 2 | Genomic Location | chr2:70,550,000-70,665,000 |  |
||
| Synonyms | 4930545J15Rik | |||||
| Links |
UCSC Genome Browser(chr2:70,550,000-70,665,000) NCBI Gene(228012) IGTC(Tlk1,3943) UNIGene(Mm.136511) |
MGI(2441683) KEGG GENES(mmu:228012) EST Profile(mm.136511) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW181 |
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB244782 | GSS Location | chr2:70,663,250-70,663,415 | Size | 167 |
| Sequence | TGGAGTCGGGCTCCCAGAAAGTAGCTTGATGAGTGTCCAAAGTAGCAGTGGAAGTTTGGAGGGGC CGCCATCTTGGTCCCGGCTCTCCACGTCTCCAACCCCGGGCTCGGCGGCGGCGGCCAGGTCCCTG CTGAATCACACGCCGCCATCCGGGAGGCCCAGGGAAG |
||||
| Links |
UCSC Browser(chr2:70,663,250-70,663,415) IGTC(Ayu21-B104) |
||||
Homology Search Results
| [BC057369] Mus musculus tousled-like kinase 1, mRNA (cDNA clone IMAGE:6834744), partial cds. |
Mouse Information
| Card ID | 606 | ||||
| Strain Name | B6;CB-Tlk1Gt(pU-21B)104Imeg | ||||
| Internal Code | Ayu21-B104 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tlk1) |
||||