Gene Name | 45S rRNA gene | Gene Symbol | 45SrRNA | |||
Chromosome | Unlocalized | Genomic Location | Unlocalized | ![]() |
||
Synonyms | ||||||
Links |
UCSC Genome Browser(Unlocalized) NCBI Gene() IGTC(45SrRNA,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
21-T189, 21-T185, 21-MT50, 21-W237, 21-27, 21-77, 21-111, 21-40, 21-B197, 21-T25, 21-B170, 21-B150, 21-T22, 21-T42, 21-T90, 21-T110, 21-T1, 21-W100, 21-B203, 21-KBW171, 21-T339, 21-T184, 21-B121, 21-T109, 21-W130, 21-T204, 21-T211, 21-B136, 21-T428, 21-T454, 21-T103, 21-T482, 21-W70, 21-W92, 21-T111, 21-MT90, 21-T284, 21-W137, 21-W212, 21-MT61, 21-KBW217, 21-W332, 21-T302, 21-MT31, 21-MT45, 21-W325, 21-W342, 21-W369, 21-W381, 21-W531, 21-W547, 21-W555, 21-MT38, 21-T205, 21-T267, 21-MT40, 21-MT53, 21-MT79, 21-MT142, 21-MT110, 21-MT114, 21-B187, 21-B199, 21-W264 |
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB248827 | GSS Location | Size | 86 | |
Sequence | CTGACCTCGCCACCCTACCGCGGCGGCGGCTGCTCGCGGGCGTCTTGCCTCTTTCCCGTCCGGCT CTTCCGTGTCTACGAGGGGCG |
||||
Links |
UCSC Browser() IGTC(Ayu21-B105) |
[X82564] M.musculus 45S pre rRNA gene. |
Card ID | 642 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for 45SrRNA) |