ID 21-B107
Registered: 2005.12.21 Last update: 2018.04.05
| Gene Name | coiled-coil domain containing 92B | Gene Symbol | Ccdc92b | |||
| Chromosome | 11 | Genomic Location | chr11:74,423,000-74,456,000 |  |
||
| Synonyms | E130309D14Rik | |||||
| Links |
UCSC Genome Browser(chr11:74,423,000-74,456,000) NCBI Gene(432582) IGTC(Ccdc92b,35277) UNIGene(Mm.274369) |
MGI(3588240) KEGG GENES(mmu:432582) EST Profile(mm.274369) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB244783 | GSS Location | chr11:74,423,822-74,423,951 | Size | 130 |
| Sequence | TCCAAGGACTCATCCTACTGAACCTTTTGGAGGTGAGCTGGGTCATCTCTTTGAAGAGAAAGGTG GGGCCATGGCTGGTGTCTTCTTGGAACTCCAGTTCTAGACTCTACCTCAGGCAGCAGGACCGCAG |
||||
| Links |
UCSC Browser(chr11:74,423,822-74,423,951) IGTC(Ayu21-B107) |
||||
Homology Search Results
| [CJ062922] RIKEN full-length enriched mouse cDNA library, C57BL/6J ES cells Mus musculus cDNA clone C330014F12 5', mRNA sequence. |
Mouse Information
| Card ID | 686 | ||||
| Strain Name | B6;CB-Ccdc92bGt(pU-21B)107Imeg | ||||
| Internal Code | Ayu21-B107 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ccdc92b) |
||||