Gene Name | retinoic acid receptor, alpha | Gene Symbol | Rara | |||
Chromosome | 11 | Genomic Location | chr11:98,786,000-98,840,000 | ![]() |
||
Synonyms | RAR alpha 1, RARalpha1 | |||||
Links |
UCSC Genome Browser(chr11:98,786,000-98,840,000) NCBI Gene(19401) IGTC(Rara,14073) UNIGene(Mm.439744) |
MGI(97856) KEGG GENES(mmu:19401) EST Profile(mm.439744) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB217779 | GSS Location | chr11:98,789,146-98,789,224 | Size | 80 |
Sequence | AATCCTGAATCGAGCTGAGAGGGCTTCCCCGGTTCTTCCTGGGAACCCCATCGCCCCCCTGCCGG CACACACCTGAGCAG |
||||
Links |
UCSC Browser(chr11:98,789,146-98,789,224) IGTC(Ayu21-B115) |
[BC008727] Homo sapiens retinoic acid receptor, alpha, mRNA (cDNA clone MGC:1651 IMAGE:3163891), complete cds. |
Card ID | 643 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Rara) |