ID 21-B115
Registered: 2005.06.15 Last update: 2006.12.29
| Gene Name | retinoic acid receptor, alpha | Gene Symbol | Rara | |||
| Chromosome | 11 | Genomic Location | chr11:98,786,000-98,840,000 |  |
||
| Synonyms | RAR alpha 1, RARalpha1 | |||||
| Links |
UCSC Genome Browser(chr11:98,786,000-98,840,000) NCBI Gene(19401) IGTC(Rara,14073) UNIGene(Mm.439744) |
MGI(97856) KEGG GENES(mmu:19401) EST Profile(mm.439744) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB217779 | GSS Location | chr11:98,789,146-98,789,224 | Size | 80 |
| Sequence | AATCCTGAATCGAGCTGAGAGGGCTTCCCCGGTTCTTCCTGGGAACCCCATCGCCCCCCTGCCGG CACACACCTGAGCAG |
||||
| Links |
UCSC Browser(chr11:98,789,146-98,789,224) IGTC(Ayu21-B115) |
||||
Homology Search Results
| [BC008727] Homo sapiens retinoic acid receptor, alpha, mRNA (cDNA clone MGC:1651 IMAGE:3163891), complete cds. |
Mouse Information
| Card ID | 643 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rara) |
||||