Gene Name | O-6-methylguanine-DNA methyltransferase | Gene Symbol | Mgmt | |||
Chromosome | 7 | Genomic Location | chr7:144,070,000-144,330,000 | ![]() |
||
Synonyms | AGT, Agat, AI267024 | |||||
Links |
UCSC Genome Browser(chr7:144,070,000-144,330,000) NCBI Gene(17314) IGTC(Mgmt,3025) UNIGene(Mm.440219) |
MGI(96977) KEGG GENES(mmu:17314) EST Profile(mm.440219) |
Other Clone Trapped This Gene |
---|
21-W336 |
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB244785 | GSS Location | chr7:144,086,279-144,086,370 | Size | 92 |
Sequence | CTGCGGCCCGTATTTCTCAGTGCCAGATCTTGGTGCTCAGGCACCTAAAACTTGTGTACCGTTCC CCGTTGCTGTCTGCAGTTTGCAAGCTG |
||||
Links |
UCSC Browser(chr7:144,086,279-144,086,370) IGTC(Ayu21-B127) |
[S82865] MGMT=06-Methylguanine-DNA methyltransferase/DNA repair methyltransferase {promoter} [mice, 129/Sv, Genomic, 2183 nt]. |
Card ID | 620 | ||||
Strain Name | B6;CB-MgmtGt(pU-21B)127Imeg | ||||
Internal Code | Ayu21-B127 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Mgmt) |