Gene Name | Pbx/knotted 1 homeobox | Gene Symbol | Pknox1 | |||
Chromosome | 17 | Genomic Location | chr17:31,700,000-31,746,000 | ![]() |
||
Synonyms | D17Wsu76e, PREP1, Prep1 | |||||
Links |
UCSC Genome Browser(chr17:31,700,000-31,746,000) NCBI Gene(18771) IGTC(Pknox1,3162) UNIGene(Mm.259295) |
MGI(1201409) KEGG GENES(mmu:18771) EST Profile(mm.259295) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB244786 | GSS Location | chr17:31,701,760-31,701,833 | Size | 79 |
Sequence | CGTGTGTTGGACGCGGGCGCGGCACTGCGGGTCCCGATTGCTGCAGCCGCTTGTCAGTGTGATGA AGATTGGCACCCAG |
||||
Links |
UCSC Browser(chr17:31,701,760-31,701,833) IGTC(Ayu21-B132) |
[AF061270] Mus musculus homeobox protein PKNOX1 (Pknox1) mRNA, complete cds. |
Card ID | 607 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Pknox1) |