ID 21-B132
Registered: 2005.12.21 Last update: 2011.02.06
| Gene Name | Pbx/knotted 1 homeobox | Gene Symbol | Pknox1 | |||
| Chromosome | 17 | Genomic Location | chr17:31,700,000-31,746,000 |  |
||
| Synonyms | D17Wsu76e, PREP1, Prep1 | |||||
| Links |
UCSC Genome Browser(chr17:31,700,000-31,746,000) NCBI Gene(18771) IGTC(Pknox1,3162) UNIGene(Mm.259295) |
MGI(1201409) KEGG GENES(mmu:18771) EST Profile(mm.259295) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB244786 | GSS Location | chr17:31,701,760-31,701,833 | Size | 79 |
| Sequence | CGTGTGTTGGACGCGGGCGCGGCACTGCGGGTCCCGATTGCTGCAGCCGCTTGTCAGTGTGATGA AGATTGGCACCCAG |
||||
| Links |
UCSC Browser(chr17:31,701,760-31,701,833) IGTC(Ayu21-B132) |
||||
Homology Search Results
| [AF061270] Mus musculus homeobox protein PKNOX1 (Pknox1) mRNA, complete cds. |
Mouse Information
| Card ID | 607 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pknox1) |
||||