ID 21-B166
Registered: 2005.12.21 Last update: 2018.04.05
| Gene Name | SOS Ras/Rac guanine nucleotide exchange factor 1 | Gene Symbol | Sos1 | |||
| Chromosome | 17 | Genomic Location | chr17:80,790,885-80,881,870 |  |
||
| Synonyms | 4430401P03Rik, AI449023, 9630010N06 | |||||
| Links |
UCSC Genome Browser(chr17:80,790,885-80,881,870) NCBI Gene(20662) IGTC(Sos1,3111) UNIGene(Mm.360004) |
MGI(98354) KEGG GENES(mmu:20662) EST Profile(mm.360004) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB244788 | GSS Location | chr17:80,879,177-80,879,295 | Size | 119 |
| Sequence | CTCCGCCCGCCCCGAGGCGCCCCGCGGGCACCATGCAGGCGCAGCAGCTGCCTTACGAGTTTTTC AGCGAGGAGAACGCGCCCAAGTGGCGGGGGCTGCTGGTGCCTGCGCTGAAAAAG |
||||
| Links |
UCSC Browser(chr17:80,879,177-80,879,295) IGTC(Ayu21-B166) |
||||
Homology Search Results
| [Z11574] M.musculus mRNA for son of sevenless 1. |
Mouse Information
| Card ID | 598 | ||||
| Strain Name | B6;CB-SosGt(pU-21B)166Imeg | ||||
| Internal Code | Ayu21-B166 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sos1) |
||||