ID 21-B171
Registered: 2006.04.24 Last update: 2024.01.24
| Gene Name | tudor domain containing 3 | Gene Symbol | Tdrd3 | |||
| Chromosome | 14 | Genomic Location | chr14:87,810,000-87,950,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr14:87,810,000-87,950,000) NCBI Gene(219249) IGTC(Tdrd3,3236) UNIGene(Mm.35168) |
MGI(2444023) KEGG GENES(mmu:219249) EST Profile(mm.35168) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB257727 | GSS Location | chr14:87,816,470-87,816,655 | Size | 184 |
| Sequence | ACAGGGGNGTTTTTTTTCTTTTNGTTTCCTTTNTTCTTTTTTCGCCCCTCTTTCTTCTTTTTCTT TTTTNTGGTGTCCAGTAGGAGGCCCGTCCCCCACCCTCAGTTCAGACCCCCGCCGTCCCCGAGCC TGAACAGCTAACCATGGCCGAGGTGTCCGGCGCCGCGTTGTCCCAGGCGGGTTG |
||||
| Links |
UCSC Browser(chr14:87,816,470-87,816,655) IGTC(Ayu21-B171) |
||||
Homology Search Results
| [BC066144] Mus musculus tudor domain containing 3, mRNA (cDNA clone MGC:76452 IMAGE:30435963), complete cds. |
Mouse Information
| Card ID | 751 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Tdrd3-null mice show post-transcriptional and behavioral impairments associated with neurogenesis and synaptic plasticity." Xingliang Zhu, Yuyoung Joo, Simone Bossi, Ross A. McDevitt, Aoji Xie, Yue Wang, Yutong Xue, Shuaikun Su, Seung Kyu Lee, Nirnath Sah, Shiliang Zhang, Rong Ye, Alejandro Pinto, Yongqing Zhang, Kimi Araki, Masatake Araki, Marisela Morales, Mark P. Mattson, Henriette van Praag, Weidong Wang, Progress in Neurobiology, 233, 102568 (2024). DOI: 10.1016/j.pneurobio.2024.102568. PubMed ID:38216113. |
||||
| Links |
IMSR (for Tdrd3) |
||||