ID 21-B195
Registered: 2006.02.28 Last update: 2018.04.05
| Gene Name | ring finger protein 24 | Gene Symbol | Rnf24 | |||
| Chromosome | 2 | Genomic Location | chr2:131,121,000-131,180,000 |  |
||
| Synonyms | C86507, D2Ertd504e, 2810473M14Rik, 4930505A13Rik, AI317164 | |||||
| Links |
UCSC Genome Browser(chr2:131,121,000-131,180,000) NCBI Gene(51902) IGTC(Rnf24,19359) UNIGene(Mm.477523) |
MGI(1261771) KEGG GENES(mmu:51902) EST Profile(mm.477523) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB252054 | GSS Location | chr2:131,178,472-131,178,582 | Size | 115 |
| Sequence | TAGTCAGCTACCGCCAGNTCANGCGGNTCGGACTCACGGACGCGGCTCTAGNAGTTTCACCGCAA GAAGCTGACTCCGGGCGCCGCCGCCCGCACGCCCGCTGCCCGTCGCCCGG |
||||
| Links |
UCSC Browser(chr2:131,178,472-131,178,582) IGTC(Ayu21-B195) |
||||
Homology Search Results
| [BC096529] Mus musculus ring finger protein 24, mRNA (cDNA clone MGC:106607 IMAGE:6406985), complete cds. |
Mouse Information
| Card ID | 638 | ||||
| Strain Name | B6;CB-Rnf24Gt(pU-21B)195Imeg | ||||
| Internal Code | Ayu21-B195 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rnf24) |
||||