Gene Name | ring finger protein 24 | Gene Symbol | Rnf24 | |||
Chromosome | 2 | Genomic Location | chr2:131,121,000-131,180,000 | ![]() |
||
Synonyms | C86507, D2Ertd504e, 2810473M14Rik, 4930505A13Rik, AI317164 | |||||
Links |
UCSC Genome Browser(chr2:131,121,000-131,180,000) NCBI Gene(51902) IGTC(Rnf24,19359) UNIGene(Mm.477523) |
MGI(1261771) KEGG GENES(mmu:51902) EST Profile(mm.477523) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB252054 | GSS Location | chr2:131,178,472-131,178,582 | Size | 115 |
Sequence | TAGTCAGCTACCGCCAGNTCANGCGGNTCGGACTCACGGACGCGGCTCTAGNAGTTTCACCGCAA GAAGCTGACTCCGGGCGCCGCCGCCCGCACGCCCGCTGCCCGTCGCCCGG |
||||
Links |
UCSC Browser(chr2:131,178,472-131,178,582) IGTC(Ayu21-B195) |
[BC096529] Mus musculus ring finger protein 24, mRNA (cDNA clone MGC:106607 IMAGE:6406985), complete cds. |
Card ID | 638 | ||||
Strain Name | B6;CB-Rnf24Gt(pU-21B)195Imeg | ||||
Internal Code | Ayu21-B195 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Rnf24) |