ID 21-B196
Registered: 2007.03.29 Last update: 2018.04.05
| Gene Name | adiponectin receptor 2 | Gene Symbol | Adipor2 | |||
| Chromosome | 6 | Genomic Location | chr6:119,302,000-119,370,000 |  |
||
| Synonyms | D6Ucla1e, 1110001I14Rik, ADCR2, Paqr2, AI115388, AW554121 | |||||
| Links |
UCSC Genome Browser(chr6:119,302,000-119,370,000) NCBI Gene(68465) IGTC(Adipor2,287) UNIGene(Mm.291826) |
MGI(93830) KEGG GENES(mmu:68465) EST Profile(mm.291826) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB299416 | GSS Location | chr6:119,367,438-119,367,543 | Size | 106 |
| Sequence | ATTACTTTCCCACATGTGCCTGGTGCAAGTCTTTCCACACAACACAAGAATCCGTGGAGCTCAGC AGTACCCTCAGACTCTGGTCTACAACTCTGACAGGATTTGG |
||||
| Links |
UCSC Browser(chr6:119,367,438-119,367,543) IGTC(Ayu21-B196) |
||||
Homology Search Results
| [AK039667] Mus musculus adult male spinal cord cDNA, RIKEN full-length enriched library, clone:A330081F11 product:hypothetical Uncharacterised protein family Hly-III/UPF0073 containing protein, full insert sequence. |
Mouse Information
| Card ID | 1437 | ||||
| Strain Name | B6;CB-Adipor2Gt(pU-21B)196Card | ||||
| Internal Code | Ayu21-B196 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Adipor2) |
||||