Gene Name | adiponectin receptor 2 | Gene Symbol | Adipor2 | |||
Chromosome | 6 | Genomic Location | chr6:119,302,000-119,370,000 | ![]() |
||
Synonyms | D6Ucla1e, 1110001I14Rik, ADCR2, Paqr2, AI115388, AW554121 | |||||
Links |
UCSC Genome Browser(chr6:119,302,000-119,370,000) NCBI Gene(68465) IGTC(Adipor2,287) UNIGene(Mm.291826) |
MGI(93830) KEGG GENES(mmu:68465) EST Profile(mm.291826) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB299416 | GSS Location | chr6:119,367,438-119,367,543 | Size | 106 |
Sequence | ATTACTTTCCCACATGTGCCTGGTGCAAGTCTTTCCACACAACACAAGAATCCGTGGAGCTCAGC AGTACCCTCAGACTCTGGTCTACAACTCTGACAGGATTTGG |
||||
Links |
UCSC Browser(chr6:119,367,438-119,367,543) IGTC(Ayu21-B196) |
[AK039667] Mus musculus adult male spinal cord cDNA, RIKEN full-length enriched library, clone:A330081F11 product:hypothetical Uncharacterised protein family Hly-III/UPF0073 containing protein, full insert sequence. |
Card ID | 1437 | ||||
Strain Name | B6;CB-Adipor2Gt(pU-21B)196Card | ||||
Internal Code | Ayu21-B196 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Adipor2) |