ID 21-B205
Registered: 2006.04.21 Last update: 2018.05.29
| Gene Name | methyl-CpG binding domain protein 5 | Gene Symbol | Mbd5 | |||
| Chromosome | 2 | Genomic Location | chr2:48,799,133-49,180,165 |  |
||
| Synonyms | Gm1630, AA536666, AI426407, 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483 | |||||
| Links |
UCSC Genome Browser(chr2:48,799,133-49,180,165) NCBI Gene(109241) IGTC(Mbd5,23466) UNIGene(Mm.440436) |
MGI(2138934) KEGG GENES(mmu:109241) EST Profile(mm.440436) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W364 |
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB257593 | GSS Location | chr2:48,873,780-48,873,845 | Size | 66 |
| Sequence | TCGACAAGAACCTGTGTATCGGATCCTAACTAAATCAAAATGTTTGAAATCAGAAGATCATGATC G |
||||
| Links |
UCSC Browser(chr2:48,873,780-48,873,845) IGTC() |
||||
Homology Search Results
| [AK155574] Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630328P13 product:hypothetical Methyl-CpG binding/Proline-rich region profile containing protein, full insert sequence. |
Mouse Information
| Card ID | 660 | ||||
| Strain Name | B6,Cg-Mbd5Gt(pU-21B)205Imeg | ||||
| Internal Code | Ayu21-B205 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Disruption of Mbd5 in mice causes neuronal functional deficits and neurobehavioral abnormalities consistent with 2q23.1 microdeletion syndrome." Camarena, V., Cao, L., Abad, C., Abrams, A., Toledo, Y., Araki, K., Araki, M., Walz, K. and Young, J. I., EMBO Molecular Medicine, 6, 1003-1015 (2014). PubMed ID:25001218. [Paper] "Trapping Mbd5 to understand 2q23.1 microdeletion syndrome." Deborah Y Kwon and Zhaolan Zhou, EMBO Molecular Medicine, 6, 993-994 (2014). PMCID:PMC4154127. |
||||
| Links |
IMSR (for Mbd5) |
||||