ID 21-B206

Registered: 2006.07.02   Last update: 2018.04.05
Gene Name lysophosphatidic acid receptor 5 Gene Symbol Lpar5
Chromosome 6 Genomic Location chr6:125,017,000-125,033,000
Synonyms LPA5, GPR93, Gpr92, LOC381810, Gm1072
Links UCSC Genome Browser(chr6:125,017,000-125,033,000)
NCBI Gene(381810)
IGTC(Lpar5,23519)
UNIGene(Mm.333386)
 MGI(2685918)
KEGG GENES(mmu:381810)
EST Profile(mm.333386)
Other Clone Trapped This Gene
Trap Vector pU-21B Cell Line KTPU8 Method 5'-RACE
Accession AB264309 GSS Location chr6:125,017,930-125,017,994 Size 66
Sequence CCGAGCCCAGAGTGTCCAGCGGAAGCAGGCTTGGGGCAGCGGCAGAGGAAGAGCAACCGATCACA
G
Links UCSC Browser(chr6:125,017,930-125,017,994)
IGTC(Ayu21-B206)

Homology Search Results

[AK131863] Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010011O04 product:G protein-coupled receptor GPR92 (Fragment), full insert sequence.

Mouse Information

Card ID 673
Strain Name B6;CB-Lpar5Gt(pU-21B)206Imeg
Internal Code Ayu21-B206
Description This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "LPA5 signaling is involved in multiple sclerosis-mediated neuropathic pain in the cuprizone mouse model." Tsukahara, R., Yamamoto, S., Yoshikawa, K., Gotoh, M., Tsukahara, T., Neyama, H., Ishii, S., Akahoshi, N., Yanagida, K., Sumida, H., Araki, M., Araki, K., Yamamura, K. I., Murakami-Murofushi, K., Ueda, H., J. Pharmacol.Sci., 136, 93-96 (2018). pii: S1347-8613(18)30004-5. doi: 10.1016/j.jphs.2018.01.001. PubMed ID:29409686.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for Lpar5)