| Gene Name | ATP-binding cassette, sub-family C (CFTR/MRP), member 4 | Gene Symbol | Abcc4 | |||
| Chromosome | 14 | Genomic Location | chr14:118,880,000-119,110,000 | |||
| Synonyms | MRP4, MOATB, D630049P08Rik, Abcc4, ABCC4-N1 | |||||
| Links |
UCSC Genome Browser(chr14:118,880,000-119,110,000) NCBI Gene(239273) IGTC(Abcc4,3512) UNIGene(Mm.40537) |
MGI(2443111) KEGG GENES(mmu:239273) EST Profile(mm.40537) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-93, 21-T201, 21-W99, 21-KBW124 |
| Trap Vector | pU-21T | Cell Line | KMB6-6 | Method | 5'-RACE |
| Accession | AB274986 | GSS Location | chr14:119,105,258-119,105,417 | Size | 160 |
| Sequence | TGCGAGGCTCCGGCCGAGGCCGGAGCTCGAGCATCCTCACCCGCGCTTCCCGGAGCCGCCGCCCG GCCGCGCGCACCGCGGGCGAGATGCTGCCGGTGCACACCGAGGTGAAACCCAACCCGCTGCAGGA CGCCAACCTCTGCTCGCGCGTGTTCTTNTG |
||||
| Links |
UCSC Browser(chr14:119,105,258-119,105,417) IGTC(Ayu21-B6T59) |
||||
| [NM_001033336] Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (Abcc4), mRNA. |
| [AK043702] Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830021K08 product:hypothetical protein, full insert sequence. |
| Card ID | 725 | ||||
| Strain Name | B6-<i>Abcc4<sup>Gt(pU-21T)59Imeg</sup></i> | ||||
| Internal Code | Ayu21-B6T59 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KMB6-6 (C57BL/6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Abcc4) |
||||