ID 21-T201
Registered: 2007.06.07 Last update: 2018.06.01
| Gene Name | ATP-binding cassette, sub-family C (CFTR/MRP), member 4 | Gene Symbol | Abcc4 | |||
| Chromosome | 14 | Genomic Location | chr14:118,880,000-119,110,000 |  |
||
| Synonyms | D630049P08Rik, MOAT-B, MRP4, MOATB, ABCC4-N1 | |||||
| Links |
UCSC Genome Browser(chr14:118,880,000-119,110,000) NCBI Gene(239273) IGTC(Abcc4,3512) UNIGene(Mm.40537) |
MGI(2443111) KEGG GENES(mmu:239273) EST Profile(mm.40537) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-93, 21-B6T59, 21-W99, 21-KBW124 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB308312 | GSS Location | chr14:119,105,264-119,105,409 | Size | 151 |
| Sequence | TCCGGCCGAGGCCGGAGCTNGAGCATCCTCACCCGCGCTTCCCGGAGCCGCCGCCCGGCCGCGCG CACCGCGGGCGAGATGCTGCCGGTGCACACCGAGGTGAAACCCAACCCGGTGCANGACGCCAACN TCTGNACGCGCGTGTTTTNAG |
||||
| Links |
UCSC Browser(chr14:119,105,264-119,105,409) IGTC(Ayu21-T201) |
||||
Homology Search Results
| [BB643073] RIKEN full-length enriched, 9.5 days embryo parthenogenote Mus musculus cDNA clone B130008G09 5', mRNA sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Abcc4) |
||||