Gene Name | chromodomain helicase DNA binding protein 1-like | Gene Symbol | Chd1l | |||
Chromosome | 3 | Genomic Location | chr3:97,364,000-97,415,000 | ![]() |
||
Synonyms | Snf2p, 4432404A22Rik, Alc1 | |||||
Links |
UCSC Genome Browser(chr3:97,364,000-97,415,000) NCBI Gene(68058) IGTC(Chd1l,4941) UNIGene(Mm.41447) |
MGI(1915308) KEGG GENES(mmu:68058) EST Profile(mm.41447) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB469854 | GSS Location | chr3:97,413,986-97,414,119 | Size | 133 |
Sequence | GAGCGAAGGCGCGGGGCCTCTCGGGATGGCGAGCGGCTTGCCGCGCTTCCTGCAGGCGCTGCCGG CCGAACACGGGCCGGAGCCGTTCGGACGCGGGTGCAGGAACCGGACTTACAGCAGTGGGGCTTGA CTG |
||||
Links |
UCSC Browser(chr3:97,413,986-97,414,119) IGTC(Ayu21-KBW100) |
[BC057567] Mus musculus chromodomain helicase DNA binding protein 1-like, mRNA (cDNA clone MGC:66868 IMAGE:6415898), complete cds. |
Card ID | 1369 | ||||
Strain Name | B6-Chd1lGt(pU-21KBW)100Card | ||||
Internal Code | Ayu21-KBW100 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Chd1l) |
Description | |
---|---|
Image | Male Female |