Gene Name | galactosidase, beta 1 | Gene Symbol | Glb1 | |||
Chromosome | 9 | Genomic Location | chr9:114,309,000-114,385,000 | |||
Synonyms | Bgl-e, Bge, Bgl, Bgl-t, Bgs, Bgt, Bgl-s, C130097A14Rik, AW125515 | |||||
Links |
UCSC Genome Browser(chr9:114,309,000-114,385,000) NCBI Gene(12091) IGTC(Glb1,4989) UNIGene(Mm.290516) |
MGI(88151) KEGG GENES(mmu:12091) EST Profile(mm.290516) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB462423 | GSS Location | chr9:114,310,266-114,310,387 | Size | 122 |
Sequence | AGAGCGCCCACTGCCTAACGGAGAGACCCCATCGTGGCGCGATCATGCTCCGGGTCCCCCTGTGT ACGCCGCTCCCGCTCCTGGCACTGCTGCAACTGCTGGGCGCTGCGCACGGCATCTAT |
||||
Links |
UCSC Browser(chr9:114,310,266-114,310,387) IGTC(Ayu21-KBW108) |
[M57734] Mouse beta-galactosidase (BGAL) gene, complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Glb1) |