ID 21-KBW110
Registered: 2008.10.03 Last update: 2018.04.06
| Gene Name | Traf3 interacting protein 2 | Gene Symbol | Traf3ip2 | |||
| Chromosome | 10 | Genomic Location | chr10:39,332,000-39,376,000 |  |
||
| Synonyms | Act1, TRAF3 interacting protein 2, Act1, CIKS, AI429613 | |||||
| Links |
UCSC Genome Browser(chr10:39,332,000-39,376,000) NCBI Gene(103213) IGTC(Traf3ip2,20434) UNIGene(Mm.436686) |
MGI(2143599) KEGG GENES(mmu:103213) EST Profile(mm.436686) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB462424 | GSS Location | chr10:39,333,049-39,333,152 | Size | 104 |
| Sequence | ACCTGGGACTGGAGAGGGCGAGGGAGGTCTGAGCGGCCCAAGGTGGATCCCCGTGAGCAGAGCCA GCGACCACCCCCTGGGCCGTCTGTCGGTGGCGATCTTAG |
||||
| Links |
UCSC Browser(chr10:39,333,049-39,333,152) IGTC(Ayu21-KBW110) |
||||
Homology Search Results
| [BC138234] Mus musculus Traf3 interacting protein 2, mRNA (cDNA clone MGC:169858 IMAGE:8861253), complete cds. |
Mouse Information
| Card ID | 1257 | ||||
| Strain Name | B6-Traf3ip2Gt(pU-21KBW)110Card | ||||
| Internal Code | Ayu21-KBW110 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Traf3ip2) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |