ID 21-KBW111

Registered: 2008.10.06   Last update: 2023.08.01
Gene Name Mir142 host gene (non-protein coding) Gene Symbol Mir142hg
Chromosome 11 Genomic Location chr11:87,569,000-87,570,900
Synonyms A430104N18Rik, AW909330
Links UCSC Genome Browser(chr11:87,569,000-87,570,900)
NCBI Gene(78591)
IGTC(Mir142hg,)
UNIGene(Mm.)
 MGI(1925841)
KEGG GENES(mmu:)
EST Profile(mm.)
Other Clone Trapped This Gene
Trap Vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB462904 GSS Location chr11:87,569,078-87,569,115 Size 39
Sequence GCACTTTGGATCCAGCTCTTCTCAGCTCTGCAGCATCAG
Links UCSC Browser(chr11:87,569,078-87,569,115)
IGTC(Ayu21-KBW111)

Homology Search Results

[AK020764] Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430104N18 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 1271
Strain Name B6-A430104N18RikGt(pU-21KBW)111Card
Internal Code Ayu21-KBW111
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "MiR-142 is required for Staphylococcus aureus clearance at skin wound sites via small GTPase-mediated regulation of the neutrophil actin cytoskeleton." Tanaka, K., Kim, S. E., Yano, H., Matsumoto, G., Ohuchida, R., Ishikura, Y., Araki, M., Araki, K., Park, S., Komatsu, T., Hayashi, H., Ikematsu, K., Tanaka, K., Hirano, A., Martin, P., Shimokawa, I., Mori, R., J. Invest, Dermatol., 137(4), 931-940 (2017). pii: S0022-202X(16)32664-1. doi: 10.1016/j.jid.2016.11.018. Epub 2016 Nov 25. PubMed ID:27894934.
[Paper] "Identification and functional analysis of inflammation-related miRNAs in skin wound repair." Mori, R., Tanaka, K., Shimokawa, I., Dev. Growth Differ., 60, 306 (2018). doi: 10.1111/dgd.12542. Epub 2018 Jun 5. PubMed ID:29873073.
[Paper] "Mir142 loss unlocks IDH2(R140)-dependent leukemogenesis through antagonistic regulation of HOX genes." Marshall, A., Kasturiarachchi, J., Datta, P., Guo, Y., Deltcheva, E., James, C., Brown, J., May, G., Anandagoda, N., Jackson, I., Howard, J. K., Ghazaly, E., Brooks, S., Khwaja, A., Araki, M., Araki, K., Linch, D., Lord, G. M., Enver, T., Nimmo, R., Sci Rep,10,19390(2020). doi: 10.1038/s41598-020-76218-8. Epub 2018 Jun 5. PubMed ID:33173219.
[Paper] "MicroRNA-142 Critically Regulates Group 2 Innate Lymphoid Cell Homeostasis and Function." Roberts, L.B., Jowett, G.M., Read, E., Zabinski, T., Berkachy, R., Selkirk, M.E., Jackson, I., Niazi, U., Anandagoda, N., Araki, M., Araki, K., Kasturiarachchi, J., James, C., Enver, T., Nimmo, R., Reis, R., Howard, J.K., Neves J.F. and Lord, G.M., J. Immunol., 206, 2725-2739 (2021). doi: 10.4049,jimmunol.org.2000647,. PubMed ID:34021046.
[Paper] "A gain-of-function mutation in microRNA 142 is sufficient to cause the development of T-cell leukemia in mice." Kawano, S., Araki, K., Bai, J., Furukawa, I., Tateishi, K., Yoshinobu, K., Usuki, S., Nimmo, R., Kaname, T., Toshihara, M., Takahashi, S., Sashida, G., Araki, M., Cancer Science, 114(7), 2821-2834(2023). doi: 10.1111/cas.15784. PubMed ID:36945113.
Links IMSR (for Mir142hg)