Gene Name | signal transducer and activator of transcription 3 | Gene Symbol | Stat3 | |||
Chromosome | 11 | Genomic Location | chr11:100,747,000-100,803,000 | ![]() |
||
Synonyms | 1110034C02Rik, Aprf, AW109958 | |||||
Links |
UCSC Genome Browser(chr11:100,747,000-100,803,000) NCBI Gene(20848) IGTC(Stat3,6642) UNIGene(Mm.249934) |
MGI(103038) KEGG GENES(mmu:20848) EST Profile(mm.249934) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB462907 | GSS Location | chr11:100,800,570-100,800,765 | Size | 196 |
Sequence | GTAGACAGGGAGGGGGAACCTGGGGTTCCGACGTCGCGGCGGAGGGAACGAGCCCTAACCGGATC GCTGAGGTACAACCCCGCTCGGTGTCGCCTGACCGCGTCGGCTAGGAGAGGCCAGGCGGCCCTCG GGAGCCCAGCAGCTCGCGCCTGGAGTCAGCGCAGGCCGGCCAGTCGGGCCTCAGCCCCGGAGACA G |
||||
Links |
UCSC Browser(chr11:100,800,570-100,800,765) IGTC(Ayu21-KBW114) |
[L29278] Mus musculus acute phase response factor (APRF) gene, complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Stat3) |