Gene Name | succinate-Coenzyme A ligase, GDP-forming, beta subunit | Gene Symbol | Suclg2 | |||
Chromosome | 6 | Genomic Location | chr6:95,420,000-95,675,000 | ![]() |
||
Synonyms | G-SCS; GTPSCS; AF171077; AW556404; D6Wsu120e; SCS-betaG | |||||
Links |
UCSC Genome Browser(chr6:95,420,000-95,675,000) NCBI Gene(20917) IGTC(Suclg2,4273) UNIGene(Mm.371585) |
MGI(1306824) KEGG GENES(mmu:20917) EST Profile(mm.371585) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB469856 | GSS Location | chr6:95,668,690-95,668,794 | Size | 106 |
Sequence | GGCCTCTCTTCAGGTTCCTGGTTAAGATGGCGTCCCCGGTGGCCATCGCGGCGCAGGCTGGGAAG CTTCTGCGAGAGCGAGCGCTGCGGCCGCTCCTGGCGGTCAG |
||||
Links |
UCSC Browser(chr6:95,668,690-95,668,794) IGTC(Ayu21-KBW131) |
[AK172633] Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830222A07 product:succinate-Coenzyme A ligase, GDP-forming, beta subunit, full insert sequence. |
Card ID | 1750 | ||||
Strain Name | B6-<i>Suclg2<sup>Gt(pU-21KBW)131Card</sup></i> | ||||
Internal Code | Ayu21-KBW131 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Two transgenic mouse models for beta subunit components of succinate-CoA ligase yielding pleiotropic metabolic alterations." Kacso, G., Ravasz, D., Doczi, J., Nemeth, B., Madgar, O., Saada, A., Ilin, P., Miller, C., Ostergaard, E., Iordanov, I., Adams, D., Vargedo, Z., Araki, M., Araki, K., Nakahara, M., Ito, H., Gal, A., Molnar, M., Nagy, Z., Patocs, A., Adam-Vizi, V. and Chinopoulos, C., Biochemical Journal, 473(20), 3463-3485 (2016). Epub 2016 Aug 5. pii: BCJ20160594. doi: 10.1042/BCJ20160594. PubMed ID:27496549. |
||||
Links |
IMSR (for Suclg2) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |