ID 21-KBW133
Registered: 2008.11.11 Last update: 2018.05.26
| Gene Name | Jupiter microtubule associated homolog 1 | Gene Symbol | Jpt1 | |||
| Chromosome | 11 | Genomic Location | chr11:115,358,000-115,376,000 |  |
||
| Synonyms | Hn1 | |||||
| Links |
UCSC Genome Browser(chr11:115,358,000-115,376,000) NCBI Gene(15374) IGTC(Jpt1,834) UNIGene(Mm.1775) |
MGI(1096361) KEGG GENES(mmu:15374) EST Profile(mm.1775) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB469858 | GSS Location | chr11:115,375,534-115,375,698 | Size | 165 |
| Sequence | GGTAGAAGCTCGTGGAGCCCTGGTGGTTTAGCTTTTGGAGTCGTCTGCGCCTGTTGGTCCCAGTC CCCCTTGGCGTTTTCAGGGCCAGCCTACCTCGCCCCTTGGCGCCATGACCACTACCACTACCTTT AAGGGTGTGGACCCTAACAGCAGGAACAGCTCCCG |
||||
| Links |
UCSC Browser(chr11:115,375,534-115,375,698) IGTC(Ayu21-KBW133) |
||||
Homology Search Results
| [AK152560] Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830079E20 product:hematological and neurological expressed sequence 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Jpt1) |
||||