Gene Name | F-box and leucine-rich repeat protein 20 | Gene Symbol | Fbxl20 | |||
Chromosome | 11 | Genomic Location | chr11:97,942,000-98,012,000 | ![]() |
||
Synonyms | 2610511F20Rik, 4632423N09Rik, C86145, Fbl2, Scr, Scrapper, AI849362; AL117906; mKIAA4147 | |||||
Links |
UCSC Genome Browser(chr11:97,942,000-98,012,000) NCBI Gene(72194) IGTC(Fbxl20,8745) UNIGene(Mm.218350) |
MGI(1919444) KEGG GENES(mmu:72194) EST Profile(mm.218350) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB604767 | GSS Location | chr11:98,010,630-98,010,719 | Size | 90 |
Sequence | GCACTCCGCACGCCGCAGCGCCCTGCCCGGGCCGCACCCGCCGGCCCCATGAGGAGGGACGTGAA CGGAGTGACCAAGAGTAGGTTTGAG |
||||
Links |
UCSC Browser(chr11:98,010,630-98,010,719) IGTC(Ayu21-KBW148) |
[NM_028149] Mus musculus F-box and leucine-rich repeat protein 20 (Fbxl20), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Fbxl20) |