ID 21-KBW165
Registered: 2011.02.06 Last update: 2018.05.27
| Gene Name | Riken cDNA E330020D12 gene | Gene Symbol | E330020D12Rik | |||
| Chromosome | 1 | Genomic Location | chr1:155,251,000-155,262,000 |  |
||
| Synonyms | Gm6648 | |||||
| Links |
UCSC Genome Browser(chr1:155,251,000-155,262,000) NCBI Gene(626058) IGTC(E330020D12Rik,24831) UNIGene(Mm.31556) |
MGI(3761270) KEGG GENES(mmu:626058) EST Profile(mm.31556) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB609133 | GSS Location | chr1:155,261,275-155,261,361 | Size | 87 |
| Sequence | GTTCCCGTAGCAGCATCGAGGTGTTCCTGAGATAAAGAAGGCTGTTGAGAAGAATCGGACCGTGT TGCGTTTTTCTTGCTGGACGAG |
||||
| Links |
UCSC Browser(chr1:155,261,275-155,261,361) IGTC() |
||||
Homology Search Results
| [NR_033736] Mus musculus Riken cDNA E330020D12 gene (E330020D12Rik), non-coding RNA. |
Mouse Information
| Card ID | 1898 | ||||
| Strain Name | B6-GE330020D12RikGt(pU-21KBW)165Card | ||||
| Internal Code | Ayu21-KBW165 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for E330020D12Rik) |
||||