Gene Name | tumor necrosis factor, alpha-induced protein 8 | Gene Symbol | Tnfaip8 | |||
Chromosome | 18 | Genomic Location | chr18:50,136,132-50,255,525 | |||
Synonyms | E130304C20Rik, Gg2-1, Gm10539, Nded, Ssc-2, Tipe, Nded;AA987150 | |||||
Links |
UCSC Genome Browser(chr18:50,136,132-50,255,525) NCBI Gene(106869) IGTC(Tnfaip8,40459) UNIGene(Mm.27740) |
MGI(2147191) KEGG GENES(mmu:106869) EST Profile(mm.27740) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB609134 | GSS Location | chr18:50,139,135-50,139,280 | Size | 146 |
Sequence | CCAGGCGCGAGCTCCACTTCTCCCGCGCTGGGGCCCGCCAGGGGTTTTAGGGGTCCGAGAGCCGC GAGCAGTCCAACTCCGGGGAACAGCATTGCGGGACCGCCCCGCTCTTCACTCGTCCCGGCGCCGC CGCGCCCTTCCTCCGA |
||||
Links |
UCSC Browser(chr18:50,139,135-50,139,280) IGTC(Ayu21-KBW166) |
[NM_001177759] Mus musculus tumor necrosis factor, alpha-induced protein 8 (Tnfaip8), transcript variant 2, mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Tnfaip8) |