ID 21-KBW190
Registered: 2011.03.29 Last update: 2018.05.27
| Gene Name | sprouty-related, EVH1 domain containing 2 | Gene Symbol | Spred2 | |||
| Chromosome | 11 | Genomic Location | chr11:19,822,705-19,925,612 |  |
||
| Synonyms | Spred-2 | |||||
| Links |
UCSC Genome Browser(chr11:19,822,705-19,925,612) NCBI Gene(114716) IGTC(Spred2,4013) UNIGene(Mm.266627) |
MGI(2150019) KEGG GENES(mmu:114716) EST Profile(mm.266627) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W534 |
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB621938 | GSS Location | chr11:19,824,866-19,824,959 | Size | 94 |
| Sequence | CGAGCGCACAGGAAGATGAAGGGAGCCAGGCTGCATGCCGCGGGACAGGCGTCTAGGTGAACAAG AAAATGACCGAAGAAACACACCCGGACGA |
||||
| Links |
UCSC Browser(chr11:19,824,866-19,824,959) IGTC(Ayu21-KBW190) |
||||
Homology Search Results
| [NM_033523] Mus musculus sprouty-related, EVH1 domain containing 2 (Spred2), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Spred2) |
||||