ID 21-KBW191
Registered: 2011.03.29 Last update: 2018.05.27
| Gene Name | Sad1 and UNC84 domain containing 2 | Gene Symbol | Sun2 | |||
| Chromosome | 15 | Genomic Location | chr15:79,553,000-79,574,000 |  |
||
| Synonyms | B230369L08Rik, Unc84b, C030011B15 | |||||
| Links |
UCSC Genome Browser(chr15:79,553,000-79,574,000) NCBI Gene(223697) IGTC(Sun2,20591) UNIGene(Mm.202715) |
MGI(2443011) KEGG GENES(mmu:223697) EST Profile(mm.202715) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB621939 | GSS Location | chr15:79,572,769-79,572,938 | Size | 170 |
| Sequence | CCCTGCCCCACTCGCGCAGCGCGGTCCTCTGCCGGCCGCATTGTCCGCTCACCGACCCCGCGCCG TCCCGCGTCTCCGCTCCGCGCGCGTTTCAGCCCCAGCCCCGGGCCCGGCCCGGCCCAGTGCGCGG CGCCGCCCGGGGGACTCCGACGCGGGAAGAACCACGCAAG |
||||
| Links |
UCSC Browser(chr15:79,572,769-79,572,938) IGTC(Ayu21-KBW191) |
||||
Homology Search Results
| [NM_194342] Mus musculus Sad1 and UNC84 domain containing 2 (Sun2), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Sun2) |
||||