Gene Name | Sad1 and UNC84 domain containing 2 | Gene Symbol | Sun2 | |||
Chromosome | 15 | Genomic Location | chr15:79,553,000-79,574,000 | ![]() |
||
Synonyms | B230369L08Rik, Unc84b, C030011B15 | |||||
Links |
UCSC Genome Browser(chr15:79,553,000-79,574,000) NCBI Gene(223697) IGTC(Sun2,20591) UNIGene(Mm.202715) |
MGI(2443011) KEGG GENES(mmu:223697) EST Profile(mm.202715) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB621939 | GSS Location | chr15:79,572,769-79,572,938 | Size | 170 |
Sequence | CCCTGCCCCACTCGCGCAGCGCGGTCCTCTGCCGGCCGCATTGTCCGCTCACCGACCCCGCGCCG TCCCGCGTCTCCGCTCCGCGCGCGTTTCAGCCCCAGCCCCGGGCCCGGCCCGGCCCAGTGCGCGG CGCCGCCCGGGGGACTCCGACGCGGGAAGAACCACGCAAG |
||||
Links |
UCSC Browser(chr15:79,572,769-79,572,938) IGTC(Ayu21-KBW191) |
[NM_194342] Mus musculus Sad1 and UNC84 domain containing 2 (Sun2), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Sun2) |