ID 21-KBW203
Registered: 2011.04.15 Last update: 2018.05.27
| Gene Name | solute carrier family 23 (nucleobase transporters), member 2 | Gene Symbol | Slc23a2 | |||
| Chromosome | 2 | Genomic Location | chr2:131,877,000-131,972,000 |  |
||
| Synonyms | mKIAA0238, Slc23a1, SVCT2, YSPL3 | |||||
| Links |
UCSC Genome Browser(chr2:131,877,000-131,972,000) NCBI Gene(54338) IGTC(Slc23a2,20820) UNIGene(Mm.103581) |
MGI(1859682) KEGG GENES(mmu:54338) EST Profile(mm.103581) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB624506 | GSS Location | chr2:131,970,748-131,970,840 | Size | 93 |
| Sequence | GCAGGCGGCTGCCGCGGGGACCCAAGGCGGCGGCAGGCACTGCGGCGCGAGCGGTGCGATCGGCG GGACGCGAGCCCAGCGAGCTGCAGGCAG |
||||
| Links |
UCSC Browser(chr2:131,970,748-131,970,840) IGTC(Ayu21-KBW203) |
||||
Homology Search Results
| [NM_018824] Mus musculus solute carrier family 23 (nucleobase transporters), member 2 (Slc23a2), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Slc23a2) |
||||