ID 21-KBW205

Registered: 2011.04.15   Last update: 2018.05.27
Gene Name WD repeat domain 11 Gene Symbol Wdr11
Chromosome 7 Genomic Location chr7:136,735,000-136,780,000
Synonyms 2900055P10Rik, Brwd2, MGC:47139, Wdr11
Links UCSC Genome Browser(chr7:136,735,000-136,780,000)
NCBI Gene(207425)
IGTC(Wdr11,53132)
UNIGene(Mm.229323)
 MGI(1920230)
KEGG GENES(mmu:207425)
EST Profile(mm.229323)
Other Clone Trapped This Gene
Trap Vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB624508 GSS Location chr7:136,735,446-136,735,577 Size 132
Sequence GTGTCGCTTCCTGCCTGCCGGTGGGGAGGGCCGGGGTGCCGCCGCGATGTTACCCTACACCGTAA
ACTTCAAGGTGTCAGCGCGCACCCTCACCGGGGCTCTCAACGCGCACAACAAGGCGGCGGTGGAC
TG
Links UCSC Browser(chr7:136,735,446-136,735,577)
IGTC(Ayu21-KBW205)

Homology Search Results

[NM_172255] Mus musculus WD repeat domain 11 (Wdr11), mRNA.

Mouse Information

Card ID 2083
Strain Name B6-<i>Wdr11<sup>Gt(pU-21KBW)205Card</sup></i>
Internal Code Ayu21-KBW205
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "WDR11-mediated Hedgehog signalling defects underlie a new ciliopathy related to Kallmann syndrome." Yeon‐Joo Kim, Daniel PS Osborn, Ji‐Young Lee, Masatake Araki, Kimi Araki, Timothy Mohun, Johanna Känsäkoski, Nina Brandstack, Hyun‐Taek Kim, Francesc Miralles, Cheol‐Hee Kim, Nigel A Brown, Hyung‐Goo Kim, Juan Pedro Martinez‐Barbera, Paris Ataliotis, Taneli Raivio, Lawrence C Layman, Soo‐Hyun Kim, EMBO reports, published online: December 20, 2017. doi: 10.15252/embr.201744632. EMBO reports,19,269-289(2018). PubMed ID:29263200.
***This paper was chosen as the cover story.***
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for Wdr11)

Expression Information

DescriptionX-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female