ID 21-KBW206
Registered: 2011.04.15 Last update: 2011.04.15
| Gene Name | annexin A11 | Gene Symbol | Anxa11 | |||
| Chromosome | 14 | Genomic Location | chr14:26,661,000-26,707,000 |  |
||
| Synonyms | Anx11, A830099O17Rik | |||||
| Links |
UCSC Genome Browser(chr14:26,661,000-26,707,000) NCBI Gene(11744) IGTC(Anxa11,13050) UNIGene(Mm.294083) |
MGI(108481) KEGG GENES(mmu:11744) EST Profile(mm.294083) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB624509 | GSS Location | chr14:26,661,674-26,661,781 | Size | 108 |
| Sequence | GCCGGCTCCTCCTTCGACCGTGCGCAGACACTCTCGGGTTAGGATCCAGGAAAGCGGGAGTAGGA AGGAGTTGCTATCCGAGCTCAGTGTCCCGGTCCCTGGTGCCAG |
||||
| Links |
UCSC Browser(chr14:26,661,674-26,661,781) IGTC(Ayu21-KBW206) |
||||
Homology Search Results
| [NM_013469] Mus musculus annexin A11 (Anxa11), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Anxa11) |
||||