ID 21-KBW215
Registered: 2011.04.15 Last update: 2018.05.28
| Gene Name | forkhead box J3 | Gene Symbol | Foxj3 | |||
| Chromosome | 4 | Genomic Location | chr4:119,211,000-119,303,000 |  |
||
| Synonyms | C330039G02Rik, Fhd6, mKIAA1041 | |||||
| Links |
UCSC Genome Browser(chr4:119,211,000-119,303,000) NCBI Gene(230700) IGTC(Foxj3,8591) UNIGene(Mm.259227) |
MGI(2443432) KEGG GENES(mmu:230700) EST Profile(mm.259227) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB624516 | GSS Location | chr4:119,212,266-119,212,450 | Size | 185 |
| Sequence | AGTTCCGGGTGCGCGGCCCCGGATGTTGGCTGCTCCCGCCGCCGCTGCCGCCGCCGCCGCCACTC TCGGCGCCGCTCCGGGCCTGGGCCGCTCTCTGAGGGCGCCGTTGGGACCTTTCGCGGGGAACGGA GACGCACGCAGCGGCCGGAGGCTCGGCCGGGCCGTCCCGGCCTGCGTAGCCTGAG |
||||
| Links |
UCSC Browser(chr4:119,212,266-119,212,450) IGTC(Ayu21-KBW215) |
||||
Homology Search Results
| [NM_172699] Mus musculus forkhead box J3 (Foxj3), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Foxj3) |
||||