ID 21-KBW242
Registered: 2011.06.22 Last update: 2018.05.28
| Gene Name | teneurin transmembrane protein 3 | Gene Symbol | Tenm3 | |||
| Chromosome | 8 | Genomic Location | chr8:49,300,000-49,770,000 |  |
||
| Synonyms | 2610100B16Rik, mKIAA1455, Odz3, Ten-m3 | |||||
| Links |
UCSC Genome Browser(chr8:49,300,000-49,770,000) NCBI Gene(23965) IGTC(Tenm3,16330) UNIGene(Mm.42191) |
MGI(1345183) KEGG GENES(mmu:23965) EST Profile(mm.42191) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB639761 | GSS Location | chr8:49,640,507-49,640,574 | Size | 68 |
| Sequence | AGACCCAGGCAAGTTGGCAGCGCCGGGCTCCGCTCCGCACGGCCACGGCGAGGGCGCGCGGCGGC AAG |
||||
| Links |
UCSC Browser(chr8:49,640,507-49,640,574) IGTC(Ayu21-KBW242) |
||||
Homology Search Results
| [NM_011857] Mus musculus odd Oz/ten-m homolog 3 (Drosophila) (Odz3), transcript variant 1, mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Tenm3) |
||||