| Gene Name | RAS-related protein-1a | Gene Symbol | Rap1a | |||
| Chromosome | 3 | Genomic Location | chr3:105,530,000-105,605,000 | |||
| Synonyms | Krev-1, Rap1, G-22K; AI848598 | |||||
| Links |
UCSC Genome Browser(chr3:105,530,000-105,605,000) NCBI Gene(109905) IGTC(Rap1a,7758) UNIGene(Mm.458171) |
MGI(97852) KEGG GENES(mmu:109905) EST Profile(mm.458171) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB639766 | GSS Location | chr3:105,604,157-105,604,271 | Size | 115 |
| Sequence | GCCGCCGCCGCCGCTCCCGAGGCCGCTGCTCCTGCCGCCGCCGTGCAGAGCCCGAGCCCGAGCCG CGGCCGAGAGGAGGGAGGAGGAGGAGGTGGAGGAGGCGCCGGGCCGCGGG |
||||
| Links |
UCSC Browser(chr3:105,604,157-105,604,271) IGTC(Ayu21-KBW249) |
||||
| [NM_145541] Mus musculus RAS-related protein-1a (Rap1a), mRNA. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rap1a) |
||||