Gene Name | polyadenylate-binding protein-interacting protein 2 | Gene Symbol | Paip2 | |||
Chromosome | 18 | Genomic Location | chr18:35,757,700-35,777,000 | ![]() |
||
Synonyms | 2310050K10Rik | |||||
Links |
UCSC Genome Browser(chr18:35,757,700-35,777,000) NCBI Gene(67869) IGTC(Paip2,6755) UNIGene(Mm.126534) |
MGI(1915119) KEGG GENES(mmu:67869) EST Profile(mm.126534) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB639771 | GSS Location | chr18:35,758,295-35,758,413 | Size | 119 |
Sequence | GGACTGGAGAAGGGAGGCGGCGGGCAAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCTGTGGAG ATCCGCGGAGGCCGACAGGATTCGTTGGCTACCGTCCCCGCTGCCGTGCACTGG |
||||
Links |
UCSC Browser(chr18:35,758,295-35,758,413) IGTC(Ayu21-KBW256) |
[NM_026420] Mus musculus polyadenylate-binding protein-interacting protein 2 (Paip2), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Paip2) |