ID 21-KBW256
Registered: 2011.06.22 Last update: 2018.05.28
| Gene Name | polyadenylate-binding protein-interacting protein 2 | Gene Symbol | Paip2 | |||
| Chromosome | 18 | Genomic Location | chr18:35,757,700-35,777,000 |  |
||
| Synonyms | 2310050K10Rik | |||||
| Links |
UCSC Genome Browser(chr18:35,757,700-35,777,000) NCBI Gene(67869) IGTC(Paip2,6755) UNIGene(Mm.126534) |
MGI(1915119) KEGG GENES(mmu:67869) EST Profile(mm.126534) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB639771 | GSS Location | chr18:35,758,295-35,758,413 | Size | 119 |
| Sequence | GGACTGGAGAAGGGAGGCGGCGGGCAAAGCGCACGTCGAGCGGGGGAGCGGCGCTGCCTGTGGAG ATCCGCGGAGGCCGACAGGATTCGTTGGCTACCGTCCCCGCTGCCGTGCACTGG |
||||
| Links |
UCSC Browser(chr18:35,758,295-35,758,413) IGTC(Ayu21-KBW256) |
||||
Homology Search Results
| [NM_026420] Mus musculus polyadenylate-binding protein-interacting protein 2 (Paip2), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Paip2) |
||||