ID 21-KBW272
Registered: 2011.08.21 Last update: 2018.05.29
| Gene Name | fatty acid binding protein 3, muscle and heart | Gene Symbol | Fabp3 | |||
| Chromosome | 4 | Genomic Location | chr4:129,985,800-129,992,800 |  |
||
| Synonyms | Fabp3, Fabph1, Fabph-1, Fabph4, Fabph-4, H-FABP, Mdgi | |||||
| Links |
UCSC Genome Browser(chr4:129,985,800-129,992,800) NCBI Gene(14077) IGTC(Fabp3,17422) UNIGene(Mm.388886) |
MGI(95476) KEGG GENES(mmu:14077) EST Profile(mm.388886) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB665548 | GSS Location | chr4:129,985,982-129,986,094 | Size | 113 |
| Sequence | GCGGTTCTCAGTGCCTGCTCGCCTCCTCACTCATCGCACCATGGCGGACGCCTTTGTCGGTACCT GGAAGCTAGTGGACAGCAAGAATTTTGATGACTACATGAAGTCACTCG |
||||
| Links |
UCSC Browser(chr4:129,985,982-129,986,094) IGTC(Ayu21-KBW272) |
||||
Homology Search Results
| [NM_010174] Mus musculus fatty acid binding protein 3, muscle and heart (Fabp3), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Fabp3) |
||||