ID 21-KBW58
Registered: 2008.09.15 Last update: 2018.05.29
| Gene Name | RNA binding motif protein 25 | Gene Symbol | Rbm25 | |||
| Chromosome | 12 | Genomic Location | chr12:84,970,000-85,025,000 |  |
||
| Synonyms | 2600011C06Rik, 2610015J01Rik, A130095G20Rik, RNPC7, AI159652, AL023075, AU043498 | |||||
| Links |
UCSC Genome Browser(chr12:84,970,000-85,025,000) NCBI Gene(67039) IGTC(Rbm25,478) UNIGene(Mm.46005) |
MGI(1914289) KEGG GENES(mmu:67039) EST Profile(mm.46005) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB453864 | GSS Location | chr12:84,973,193-84,973,367 | Size | 175 |
| Sequence | AAGCCCTCCAGGAGCTCCCCGCGCAGCGCGGCTGTGTTTTGCGGCCTAGGCGAGTAGGCGCTTCG GAACCAGTCTCTAGAGTCGGGCGGCGCGCAGACACCTCGAACCGGTGGAGCCCCACTCCATCACC TGACGCCCAGAGGCCGCGAAGACAGTACCGTTTTCTTAGCGGCGG |
||||
| Links |
UCSC Browser(chr12:84,973,193-84,973,367) IGTC(Ayu21-KBW58) |
||||
Homology Search Results
| [NM_027349] Mus musculus RNA binding motif protein 25 (Rbm25), mRNA. |
Mouse Information
| Card ID | 1306 | ||||
| Strain Name | B6-Rbm25Gt(pU-21KBW)58Card | ||||
| Internal Code | Ayu21-KBW58 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rbm25) |
||||