| Gene Name | kinesin family member 24 | Gene Symbol | Kif24 | |||
| Chromosome | 4 | Genomic Location | chr4:41,335,000-41,413,000 | |||
| Synonyms | 4933425J19Rik, 9430029L23Rik | |||||
| Links |
UCSC Genome Browser(chr4:41,335,000-41,413,000) NCBI Gene(109242) IGTC(Kif24,8364) UNIGene(Mm.370288) |
MGI(1918345) KEGG GENES(mmu:109242) EST Profile(mm.370288) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB453865 | GSS Location | chr4:41,411,743-41,411,920 | Size | 178 |
| Sequence | GTCGGCGCGCGCGTTCGAACTGGCGCTTGTGGCGTTGCCATGGGGATGTGGCCTGGCGGACACCT AAGGCGGGTTGACCGGACGCTCTGCTAGCCCGGCCTTAGGGCTTTCTCCTCACCGCACTATTTCT TCGGTCCTCCCTTAAAACTGACTGAGGAGGAGCCGGGATTGCCCTGAG |
||||
| Links |
UCSC Browser(chr4:41,411,743-41,411,920) IGTC(Ayu21-KBW59) |
||||
| [AK020445] Mus musculus 12 days embryo embryonic body between diaphragm region, and neck cDNA, RIKEN full-length enriched library, clone:9430029L23, product:kinesin family member 24, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Kif24) |
||||