ID 21-KBW60
Registered: 2008.09.15 Last update: 2018.05.29
| Gene Name | transcription factor 12 | Gene Symbol | Tcf12 | |||
| Chromosome | 9 | Genomic Location | chr9:71,685,000-71,965,000 |  |
||
| Synonyms | ALF1, bHLHb20, HEB, HEBAlt, HTF4, HTF-4, ME1, REB, A130037E08Rik | |||||
| Links |
UCSC Genome Browser(chr9:71,685,000-71,965,000) NCBI Gene(21406) IGTC(Tcf12,7063) UNIGene(Mm.171615) |
MGI(101877) KEGG GENES(mmu:21406) EST Profile(mm.171615) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB453866 | GSS Location | chr9:71,848,223-71,848,325 | Size | 116 |
| Sequence | TGATTCATCTAGAGGTTTTACAGACAGCCCTCATTACAGTGATCACTTGAATGACAGTCGATTAG GAACCCACGAAGGCTTGTCCCCAACACCTTTCATGAACTCAAATCTGATAG |
||||
| Links |
UCSC Browser(chr9:71,848,223-71,848,325) IGTC(Ayu21-KBW60) |
||||
Homology Search Results
| [X64840] M.musculus ALF1 mRNA. |
Mouse Information
| Card ID | 1258 | ||||
| Strain Name | B6-Tcf12Gt(pU-21KBW)60Card | ||||
| Internal Code | Ayu21-KBW60 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tcf12) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |