ID 21-KBW71
Registered: 2008.09.15 Last update: 2018.05.29
| Gene Name | ubiquitin-conjugating enzyme E2 variant 1 | Gene Symbol | Ube2v1 | |||
| Chromosome | 2 | Genomic Location | chr2:167,433,000-167,458,000 |  |
||
| Synonyms | 0610011J09Rik, CROC1, D7Bwg1382e, UEV-1, CROC-1, AI256840 | |||||
| Links |
UCSC Genome Browser(chr2:167,433,000-167,458,000) NCBI Gene(66589) IGTC(Ube2v1,36919) UNIGene(Mm.360108) |
MGI(1913839) KEGG GENES(mmu:66589) EST Profile(mm.360108) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB457016 | GSS Location | chr2:167,457,440-167,457,505 | Size | 66 |
| Sequence | GGGGGGTGAAGAAGGGGCCGGCCTTCGAGCGACAGCGACGCAAGATGGCAGCCACCACAGGCTCG G |
||||
| Links |
UCSC Browser(chr2:167,457,440-167,457,505) IGTC(Ayu21-KBW71) |
||||
Homology Search Results
| [AK158230] Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930043P20 product:ubiquitin-conjugating enzyme E2 variant 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ube2v1) |
||||