ID 21-KBW81
Registered: 2008.09.15 Last update: 2018.05.29
| Gene Name | SH3 domain protein D19 | Gene Symbol | Sh3d19 | |||
| Chromosome | 3 | Genomic Location | chr3:85,770,000-85,940,000 |  |
||
| Synonyms | Kryn; AW011754 | |||||
| Links |
UCSC Genome Browser(chr3:85,770,000-85,940,000) NCBI Gene(27059) IGTC(Sh3d19,9514) UNIGene(Mm.2454) |
MGI(1350923) KEGG GENES(mmu:27059) EST Profile(mm.2454) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB457022 | GSS Location | chr3:85,775,234-85,844,787 | Size | 153 |
| Sequence | CATGGCTGAGGGCCGGCGGCGGGAGGACGAGGAGGAAGAGCTGCGAGAGCGCCGCGAGCTTGGGG GCCCGCGCCGCGCCCGGAGCCGCGCGCTCCCGGGCCACTCGGCTGCAGATCGCAACGAGCGACAT AAGCCAGAGCATCGTTCTTCCAG |
||||
| Links |
UCSC Browser(chr3:85,775,234-85,844,787) IGTC(Ayu21-KBW81) |
||||
Homology Search Results
| [AK187574] Mus musculus cDNA, clone:Y0G0142F05, strand:unspecified. |
Mouse Information
| Card ID | 1863 | ||||
| Strain Name | B6-Sh3d19Gt(pU-21KBW)81Card | ||||
| Internal Code | Ayu21-KBW81 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sh3d19) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |