ID 21-KBW85
Registered: 2008.09.15 Last update: 2018.05.29
| Gene Name | predicted gene 12588 | Gene Symbol | Gm12588 | |||
| Chromosome | 11 | Genomic Location | chr11:121,766,817-121,788,128 |  |
||
| Synonyms | OTTMUSG00000007612 | |||||
| Links |
UCSC Genome Browser(chr11:121,766,817-121,788,128) NCBI Gene(100503228) IGTC(Gm12588,36136) UNIGene(Mm.) |
MGI(3800295) KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB458376 | GSS Location | chr11:121,786,544-121,786,645 | Size | 102 |
| Sequence | AATTAGTCGCTGAGAGGCTTGAATGGGCCTGTGTGCTGTGCTCCTTGTTCTGCGGCTGGATGCTG TGGACTGTGCTTAGGCAAGCTCCGAAGTTGCGACATG |
||||
| Links |
UCSC Browser(chr11:121,786,544-121,786,645) IGTC(Ayu21-KBW85) |
||||
Homology Search Results
| [CZ294402] P066H05 GV09C05 Mus musculus cDNA clone P066H05, mRNA sequence. German Genetrap Consortium (GGTC). |
Mouse Information
| Card ID | 1886 | ||||
| Strain Name | B6-Gm12588Gt(pU-21KBW)85Card | ||||
| Internal Code | Ayu21-KBW85 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Gm12588) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |