ID 21-KBW90
Registered: 2008.09.15 Last update: 2018.05.29
| Gene Name | electron transferring flavoprotein, beta polypeptide | Gene Symbol | Etfb | |||
| Chromosome | 7 | Genomic Location | chr7:50,699,000-50,714,000 |  |
||
| Synonyms | 0610009I16Rik, 2810441H06Rik | |||||
| Links |
UCSC Genome Browser(chr7:50,699,000-50,714,000) NCBI Gene(110826) IGTC(Etfb,23015) UNIGene(Mm.30200) |
MGI(106098) KEGG GENES(mmu:110826) EST Profile(mm.30200) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB458377 | GSS Location | chr7:50,699,500-50,699,574 | Size | 75 |
| Sequence | AGTGACTGCTGCAGGAAGATGGCGGAGCTGCGCGCGCTCGTGGCTGTCAAGAGGGTCATCGACTT CGCTGTGAAG |
||||
| Links |
UCSC Browser(chr7:50,699,500-50,699,574) IGTC(Ayu21-KBW90) |
||||
Homology Search Results
| [BC069877] Mus musculus electron transferring flavoprotein, beta polypeptide, mRNA (cDNA clone MGC:78079 IMAGE:5370580), complete cds. |
Mouse Information
| Card ID | 1270 | ||||
| Strain Name | B6-EtfbGt(pU-21KBW)90Card | ||||
| Internal Code | Ayu21-KBW90 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Etfb) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |