ID 21-MT48
Registered: 2013.02.22 Last update: 2018.05.31
| Gene Name | fat mass and obesity associated | Gene Symbol | Fto | |||
| Chromosome | 8 | Genomic Location | chr8:93,830,000-94,200,000 |  |
||
| Synonyms | AW743446, mKIAA1752, Fatso | |||||
| Links |
UCSC Genome Browser(chr8:93,830,000-94,200,000) NCBI Gene(26383) IGTC(Fto,6884) UNIGene(Mm.4375) |
MGI(1347093) KEGG GENES(mmu:26383) EST Profile(mm.4375) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T95, 21-W21 |
| Trap Vector | pU-21T | Cell Line | Mol/MSM-1 | Method | 5'-RACE |
| Accession | AB694945 | GSS Location | chr8:93,837,431-93,837,519 | Size | 89 |
| Sequence | GGGGGAACACGGCCCACGGTGGCGAAGGCGGCTTTAGTAGCAGCATGAAGCGCGTCCAGACCGCG GAGGAACGAGAGCGGGAAGCTAAG |
||||
| Links |
UCSC Browser(chr8:93,837,431-93,837,519) IGTC() |
||||
Homology Search Results
| [AK049502] Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430017N20 product:fatso, full insert sequence. |
Mouse Information
| Card ID | 1946 | ||||
| Strain Name | MSM/Ms-FtoGt(pU-21MT)48Card | ||||
| Internal Code | Ayu21-MT48 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Fto) |
||||