Gene Name | fat mass and obesity associated | Gene Symbol | Fto | |||
Chromosome | 8 | Genomic Location | chr8:93,830,000-94,200,000 | ![]() |
||
Synonyms | AW743446, mKIAA1752, Fatso | |||||
Links |
UCSC Genome Browser(chr8:93,830,000-94,200,000) NCBI Gene(26383) IGTC(Fto,6884) UNIGene(Mm.4375) |
MGI(1347093) KEGG GENES(mmu:26383) EST Profile(mm.4375) |
Other Clone Trapped This Gene |
---|
21-T95, 21-MT48 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB430397 | GSS Location | chr8:93,837,439-93,837,519 | Size | 83 |
Sequence | CGACGGCCCACGGTGGCGAAGGCGGCTTTAGTAGCAGCATGAAGCGCGTCCAGACCGCGGAGGAA CGAGAGCGGGAAGCTAAG |
||||
Links |
UCSC Browser(chr8:93,837,439-93,837,519) IGTC(Ayu21-W21) |
[AK049502] Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430017N20 product:fatso, full insert sequence. |
Card ID | 1164 | ||||
Strain Name | B6;CB-FtoGt(pU-21W)21Imeg | ||||
Internal Code | Ayu21-W21 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Fto) |