ID 21-T12
Registered: 2006.07.02 Last update: 2018.05.31
| Gene Name | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | Gene Symbol | Slc7a1 | |||
| Chromosome | 5 | Genomic Location | chr5:149,138,000-149,214,000 |  |
||
| Synonyms | 4831426K01Rik, Atrc1, Atrc-1, Cat1, mCAT-1, Rec-1, Rev-1, AI447493 | |||||
| Links |
UCSC Genome Browser(chr5:149,138,000-149,214,000) NCBI Gene(11987) IGTC(Slc7a1,6596) UNIGene(Mm.275489) |
MGI(88117) KEGG GENES(mmu:11987) EST Profile(mm.275489) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W214, 21-W355, 21-W239 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB264300 | GSS Location | chr5:149,211,305-149,211,412 | Size | 108 |
| Sequence | ATGAAACCGGCTCGGATTCCGCCCGCGTGCGCCATCCCCTCAGCTAGCAGGTGTGAGAGGCTTTC TACCCGCGGTCTCCACACAGCTCAACATCTTGCCGCCTCCTCC |
||||
| Links |
UCSC Browser(chr5:149,211,305-149,211,412) IGTC() |
||||
Homology Search Results
| [AK139342] Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830015N05 product:solute carrier family 7 (cationic amino acid transporter, y+ system), member 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Slc7a1) |
||||