ID 21-W355

Registered: 2009.08.29   Last update: 2010.01.04
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 Gene Symbol Slc7a1
Chromosome 5 Genomic Location chr5:149,138,000-149,214,000
Synonyms Atrc1, Atrc-1, mCAT-1, Cat1, Rev-1, Rec-1, AI447493, 4831426K01Rik
Links UCSC Genome Browser(chr5:149,138,000-149,214,000)
NCBI Gene(11987)
IGTC(Slc7a1,6596)
UNIGene(Mm.275489)
MGI(88117)
KEGG GENES(mmu:11987)
EST Profile(mm.275489)
Other Clone Trapped This Gene
21-T12, 21-W214, 21-W239
Trap Vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB517954 GSS Location chr5:149,211,305-149,211,421 Size 117
Sequence GCGCGGCTGATGAAACCGGCTCGGATTCCGCCCGCGTGCGCCATCCCCTCAGCTAGCAGGTGTGA
GAGGCTTTCTACCCGCGGTCTCCACACAGCTCAACATCTTGCCGCCTCCTCC
Links UCSC Browser(chr5:149,211,305-149,211,421)
IGTC(Ayu21-W355)

Homology Search Results

[NM_007513] Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), mRNA.

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Slc7a1)