ID 21-W355
Registered: 2009.08.29 Last update: 2010.01.04
| Gene Name | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | Gene Symbol | Slc7a1 | |||
| Chromosome | 5 | Genomic Location | chr5:149,138,000-149,214,000 |  |
||
| Synonyms | Atrc1, Atrc-1, mCAT-1, Cat1, Rev-1, Rec-1, AI447493, 4831426K01Rik | |||||
| Links |
UCSC Genome Browser(chr5:149,138,000-149,214,000) NCBI Gene(11987) IGTC(Slc7a1,6596) UNIGene(Mm.275489) |
MGI(88117) KEGG GENES(mmu:11987) EST Profile(mm.275489) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T12, 21-W214, 21-W239 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB517954 | GSS Location | chr5:149,211,305-149,211,421 | Size | 117 |
| Sequence | GCGCGGCTGATGAAACCGGCTCGGATTCCGCCCGCGTGCGCCATCCCCTCAGCTAGCAGGTGTGA GAGGCTTTCTACCCGCGGTCTCCACACAGCTCAACATCTTGCCGCCTCCTCC |
||||
| Links |
UCSC Browser(chr5:149,211,305-149,211,421) IGTC(Ayu21-W355) |
||||
Homology Search Results
| [NM_007513] Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Slc7a1) |
||||