ID 21-T210
Registered: 2007.07.13 Last update: 2010.03.18
| Gene Name | RIKEN cDNA 2410006H16 gene | Gene Symbol | 2410006H16Rik | |||
| Chromosome | 11 | Genomic Location | chr11:62,416,300-62,418,400 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr11:62,416,300-62,418,400) NCBI Gene(69221) IGTC(2410006H16Rik,23357) UNIGene(Mm.270874) |
MGI(1916471) KEGG GENES(mmu:) EST Profile(mm.270874) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B6T17, 21-T20, 21-T36, 21-W125, 21-W263 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332322 | GSS Location | chr11:62,416,379-62,416,525 | Size | 148 |
| Sequence | CTCNGCGGCCATCATGGGATCGTGCTCTTCTCGCTCGTTGAGCTGGTCCCTTCGCCGTGGCCTGC TGGTGACGGTACTGGAGCGATGCTGAGCCCGGGCCCAGCCTCTCAGCTCCGCCTTGTGCGCTGCA CAGATCTANTGGAGCCTG |
||||
| Links |
UCSC Browser(chr11:62,416,379-62,416,525) IGTC(Ayu21-T210) |
||||
Homology Search Results
| [AK010427] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410006H16 product:unclassifiable, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for 2410006H16Rik) |
||||